Wednesday, September 14, 2005

Deepak Chopra and the atrocity that is creationist mathematics.


Having taken a myriad of post-grad courses in mathematics, your humble correspondent has a fundamental love for all things mathematical, which is why shit like this really gripes my wagger.

Deepak Chopra is a New Age spiritual wingnut and con artist. More to the point, he is no mathematician, as he demonstrated not that long ago on the Larry King Show (the one forum where one can show up, say the stupidest goddamned things imaginable, and have Larry just nod in bogus understanding and go on to the next question).

Specifically, the topic was creationism/Intelligent Design, during which Chopra dragged out that hopelessly irrelevant non-analogy about the improbability of life and evolution:

CHOPRA: You know, I think it shows such a lot of arrogance, such a lot arrogance and no humility whatsoever to assume that this multiple universes that are right now exploding and dissolving into singularities and all the workings of nature are accidental. It's like a hurricane blew through your junkyard and it left and now you have a Boeing 747 and it's all accidental. It shows tremendous arrogance, Larry.

This is a very popular analogy amongst the unwashed masses -- the hurricane, the junkyard, the 747. Calculating huge probabilities are wonderfully popular among the creationist lower classes. They like nothing better than claiming that the chance of something like DNA forming totally "at random" is, like, 10 to the power lots and lots and lots of zeroes, and stuff equally misinformed.

Let me eviscerate this idiocy once and for all. And for this, I will need a simple deck of playing cards. Feel free to play along at home.

Say I take a regular deck of 52 cards, shuffle it thoroughly and deal out a regular 5-card poker hand. Now, being someone that understands simple probability, I can tell you that there are exactly 2,598,960 different possible hands (ignoring the order in which the cards were dealt). Consequently, it means that the probability of dealing exactly the hand that I just dealt would be, of course, one in 2,598,960. With me so far?

Well, then, if you agree with that (and you really have no choice), then you have to agree that I just did something amazingly improbable, don't you? Huh, you say? Sure, I say, based on only the math, I just dealt a poker hand whose chance of being dealt was a miniscule one in 2,598,960. Is that incredible or what? Man, talk about the odds of that! Are you impressed?

Of course not, you'll say, what's to be impressed with? Wait, I say, you don't think what I just did is an amazing statistical feat, it having the odds of about one in two and a half million? No, you'll say. At which point, I'll take all the cards, shuffle the deck again, hand it to you and say, all right, smartass, you do it.

In other words, from a thoroughly shuffled deck, if you're not impressed with what I just did, you do it -- deal out exactly the same 5-card hand. Not so easy now, is it?

Hold on, you'll complain, that's not fair. Why, yes, you're right -- it isn't fair. And why not? It's because, when I dealt my hand, I never made any predictions or put any conditions on the outcome beforehand. I just dealt the hand and, after the fact, went back to rationalize (in a totally meaningless way) the odds of that having happened.

When I shuffle the deck and hand it to you, though, I'm asking you to duplicate, at random, what I just did. And that's a whole new problem.

You can see the same statistical misunderstanding if you walk up to a bridge game, look at each of the players' initial hand of 13 cards, and calculate the incredibly low probability of a random dealing having come up with exactly that set of hands.

Finally, others have referred to this mathematical misunderstanding as the "blade of grass" fallacy, in which a golfer hits a ball onto the green, walks up to his ball and stands there marveling that, out of all of the blades of grass the ball might have come to rest on, it stopped on just that one. How amazing. How incredibly improbable. How thoroughly bogus, as I'm sure you're starting to understand by now.

The mathematical fallacy should now be obvious -- there's no point in calculating the odds of something happening if it's just being done after the fact and there were no pre-conditions to start with. And this is precisely what the creationists/ID proponents do with things like the structure of DNA.

Look, they'll say, DNA is so marvelously complex. It has exactly these components in exactly this order. What are the odds of that? To which the correct answer is, that question is meaningless. It might have been just as likely some other structure that worked equally well.

At this point, I'm assuming most moderately sentient readers will understand the logical flaw in this creationist argument. And for those of you who don't, well, I have a deck of cards with your mathematically illiterate name on it.

FYI: PZ Myers (among many others) laid a beating on Chopra as well.

WEASEL BOY UPDATE: Apparently, Weasel Boy himself takes exception with my mathematical analysis in the comments section, proving only that he still doesn't get the point, referring to some sort of analogous "royal flush" of DNA. So here's what I'm going to do.

From a site on the net, I downloaded the human chromosome 6 sequence file. According to that site:

Chromosome 6 is a submetacentric chromosome that constitutes about 6% of the human genome. The finished sequence comprises 166,880,988 base pairs, representing the largest chromosome sequenced so far. The entire sequence has been subjected to high-quality manual annotation, resulting in the evidence-supported identification of 1,557 genes and 633 pseudogenes.

I downloaded the entire (174M) uncompressed sequence file and, from the four choices below, I want Weasel Boy to select the one that corresponds to the opening sequence of that chromosome. No cheating by looking it up. WB seems to think it should be obvious to distinguish a "royal flush" from meaningless random data so it should be a snap for him to pick out the actual opening sequence from the other three choices which are just random strings I pulled out of my ass.

So, Jinx, just from visual inspection, which of these strings actually corresponds to the beginning of human chromosome 6? Which of these, as you would put it, is the obvious "royal flush" as compared to the others?
  1. CCATATAATTTATTAATTGTCTAGGAACTTCCACATACATTGCCTCAATT
  2. TTATGCTTTCAAAATATTCTTTTGCTAATTCTTAGAACAAAGAAAGGCAT
  3. AAATTTATTTGGTCCATTTTGTGAAAAACATAAAAAAAGAACTGTCACAT
  4. GATCTTATATAACTGTGAGATTAATCTCAGATAATGACACAAAATATAGT

Go on, Jinx. Which one is it? Surely a clever boy like you can pick out the actual sequence from all that random data.

AFTERSNARK: I know that Jinx is going to hideously misunderstand this last challenge so let me clarify the point that is being made here for those of you whose brain stems are still functioning and have not been deadened by years of immersion in anti-intellectual fundamentalist Christianity.

The proponents of ID are constantly yammering on about how there is such obvious "design" or "complexity" in nature that it simply could not have arisen by chance. If this is indeed the case, then it should be simple to look at such examples and point out what it is about them that makes them "complex" or "designed" (whatever that means since these same proponents are singularly unable to provide even a vague working definition.)

With that in mind, I want Weasel Boy to pick out, from the four sequences above, the one that has that inherent "design" or "complexity" that distinguishes it from the random noise of the other three sequences. If he can't, then all of his arguments regarding probability and design are total hoo-hah.

Have I made my point?

18 comments:

Mike said...

CC,

This is brilliant. I intend to use this with the idiot ID/ Creationists I deal with occasionally.

Keep it up.

pretty shaved ape said...

i don't suppose it is remotely arrogant or lacking in humility to suppose that the universe was a bubbling endless expanse of matter and energy until, all of a sudden, a magical super-entity said wooja- wooja and waved his/her/its wand in order to deposit life on one lonely rock. i mean really, what are the odds of that. where is this ultimo-being lately? oh, he's all wrapped up in being mysterious and only a select few get to hear his whispered instructions and take memos from beyond. and what does this creator seem to want in return? why, no more than a little praise and worship. because super, vast intelligent beings that can craft dna, weave the elements, and give us the micorcosmic and macrocosmic universe are kind of needy that way. if such a creature were to exist it sure as fuck wouldn't be talking to falwell or robertson. and supposing it gave a galaxy sized crap how we behaved for our teensie little selves, i rather imagine it would be the televangelly heads that would be among the first to feel the smite. at least i have found the true faith, touched by his noodly appendage, the flying spaghetti monster and i look forward to my beer volcano rewards. at least that makes sense.

Anonymous said...

A hurricane is but one event - billions of biological events happen around the world every day.

If billions of hurricanes rolled through the same junkyard, you just might find a 747 eventually.

- Millions to one odds happen nine times out of ten - Terry Pratchett

Timmy the G said...

Nicely done, CC. You have the mathematically the existence of wingnuts, despite the fact that the odds of their being so profoundly stupid must be astronomical.

Anonymous said...

Am i mistaken or is the probability actually 311,875,200. I am no math guy but isn't it 52x51x50x49x48?

CC said...

Am i mistaken or is the probability actually 311,875,200. I am no math guy but isn't it 52x51x50x49x48?

You are indeed mistaken. I will leave it as an exercise to the reader to point out the subtle flaw in your calculation.

Jim said...

The Internet: repository of all knowledge.

Jason said...

A poker analogy. Cute, but seriously flawed. Using the poker analogy, the creation of a viable DNA strand would be analagous to dealing a royal flush. We're not just dealing with any combination of cards or "some other [combination of cards] that worked equally well." We're dealing with the best winning hand possible.

Furthermore, instead of a 52-card deck and a 5-card hand, we're dealing with a 4-card deck and a 3 to 4 billion-card hand. Now, you certainly can argue - feebly - that just any combination of base pairs in any order will produce a viable strand of DNA or "some other [completely imaginary] structure that worked equally well [I'd like to see that!]," but I know that you know that would be foolish of you. Try to play poker like that. ("My random sequence of cards beats your royal flush!")

Finally, you're looking at the winning poker hand after it has been dealt, not before. You are looking backwards from the conclusion, so the prediction/condition is already there: DNA formed and life exists.

pretty shaved ape said...

jinx, one could also argue that the billions of cards in the hand could be analogous to the billions of planetary bodies in the universe and that the royal flush/random hand just happened to have been dealt here. and how is it that intelligent design/creationism is not looking back from the conclusion? oh, right, because sky magic being told some guys and they wrote it all down in the wake of their halluci....visions. mystic rationalizations are somehow superior as long as it is your brand of mysticism doing the rationalizing. i guess we won't be seeing you at the gates of the stripper factory in the great whatever after. and calling an argument feeble is hardly a refutation when you have no plausible alternative.

Adam said...

Jinx;

You missed the main point of the post. We're not "dealing with the best winning hand possible". We're dealing with a particular hand that we happen to know has already been dealt.

At the risk of being too cute with words, it really is arrogant to assume that our DNA sequence is the "best" there could possibly be without any kind of evidence.

CC said...

Weasel Boy writes:

A poker analogy. Cute, but seriously flawed.

Coming soon: WB educates that ignorant hack Stephen Hawking on how quantum physics really works.

Anonymous said...

Jinx - the key point that all of the ID arguments hinge upon is the immensely high odds against.

Oddly - this is precisely where they fall flat on their intellectual arses - they fail to ask the "why not?" question.

Odds being stacked against something doesn't make it impossible - improbable, yes, but not impossible. The duck-billed platypus is improbable, but indisputably it exists, n'est ce pas?.

You may accept Behe's (et. al) argument that the complexity of biological organisms is such that the odds favor a designer intervention, but you must also reasonably acknowledge that with billions of biological events happening all the time, around the world, that the probability theory holds at least as much validity.

CC's argument was quite legitimate - sit back and ask yourself the "why not?" question, and you will find the ID line suddenly isn't quite as compelling as it appears at first blush.

Anonymous said...

i still do not understand the subtle flaw. please explain.

CC said...

The subtle flaw is that you shouldn't count, as different, hands that are simply dealt in a different order.

If you ignore the order of dealing, the total number of distinct hands is

(52*51*50*49*48)/(5*4*3*2*1).

What you did was to count all possible dealings, which is not the same thing.

(This is a simple example of "combinatorics," which is simply the field of mathematics that deals with the science of counting things.)

Anonymous said...

Got it, A-K-Q-J-10 is the same hand as 10-J-Q-K-A. Thanks for the math lesson.

Doug Rusta said...

A better way of understanding the origins of life from a mathematical perspective is to consider a theorem proven by the Briton, Frank Plumpton Ramsey, about 75 years ago. It says that if a sufficiently large space is filled by points arranged randomly, it is always possible to find some in a region that form an ordered pattern. Thus, if the space corresponds to the Universe, and if the points represent atoms of various chemical elements, it is then reasonable to expect that patterns will result in the form of complex molecules. Such molecules would be further encouraged by the nature of the chemical bond, the electromagnetic energy in space available to create and destroy such bonds, and the existence of regions where the birth of such molecules might be encouraged as a result of gravitation and stellar wind pressure effects. Indeed, the spectra of amino acid-like molecules have been observed in deep space.

It thus would be a miracle if life did not exist throughout the Universe. Life formed by natural processes over vast periods of time independent of the effort of a creator or a so-called intelligent designer.

Anonymous said...

I have a degree in math. You're a moron. Sorry, but you're such a dope, there's nowhere to begin. You don't know the first week of undergradute introductory statistics.


You can believe that water, carbon, nitrogen, and hydrogen, got together and became a cheetah. It's America, you can believe that. But it's silly, it's stupid. Keep dealing out that rare hand of cards, man. The notion that water + nitrogen + "long long time, very long" might make life is stupidity.

Panagiotes Koutelidakes said...

I love how an anonymous comment at the end of a post somehow constitutes legitimacy... Oh, the (disgusting aspects of) humanity!

On another note, very well written article. :)

Another matter that is of particular interest is that the most common examples regarding the "creation" supports include a human observer and some form of artefact being deduced as such, whereas the same, the theory goes on, cannot be said about peculiar rocks. What, then, of stromatolites, who look very much like weird rocks? :P