Deepak Chopra and the atrocity that is creationist mathematics.

Having taken a myriad of post-grad courses in mathematics, your humble correspondent has a fundamental love for all things mathematical, which is why shit like this really gripes my wagger.

Deepak Chopra is a New Age spiritual wingnut and con artist. More to the point, he is no mathematician, as he demonstrated not that long ago on the Larry King Show (the one forum where one can show up, say the stupidest goddamned things imaginable, and have Larry just nod in bogus understanding and go on to the next question).

Specifically, the topic was creationism/Intelligent Design, during which Chopra dragged out that hopelessly irrelevant non-analogy about the improbability of life and evolution:

CHOPRA: You know, I think it shows such a lot of arrogance, such a lot arrogance and no humility whatsoever to assume that this multiple universes that are right now exploding and dissolving into singularities and all the workings of nature are accidental. It's like a hurricane blew through your junkyard and it left and now you have a Boeing 747 and it's all accidental. It shows tremendous arrogance, Larry.

This is a very popular analogy amongst the unwashed masses -- the hurricane, the junkyard, the 747. Calculating huge probabilities are wonderfully popular among the creationist lower classes. They like nothing better than claiming that the chance of something like DNA forming totally "at random" is, like, 10 to the power lots and lots and lots of zeroes, and stuff equally misinformed.

Let me eviscerate this idiocy once and for all. And for this, I will need a simple deck of playing cards. Feel free to play along at home.

Say I take a regular deck of 52 cards, shuffle it thoroughly and deal out a regular 5-card poker hand. Now, being someone that understands simple probability, I can tell you that there are exactly 2,598,960 different possible hands (ignoring the order in which the cards were dealt). Consequently, it means that the probability of dealing exactly the hand that I just dealt would be, of course, one in 2,598,960. With me so far?

Well, then, if you agree with that (and you really have no choice), then you have to agree that I just did something amazingly improbable, don't you? Huh, you say? Sure, I say, based on only the math, I just dealt a poker hand whose chance of being dealt was a miniscule one in 2,598,960. Is that incredible or what? Man, talk about the odds of that! Are you impressed?

Of course not, you'll say, what's to be impressed with? Wait, I say, you don't think what I just did is an amazing statistical feat, it having the odds of about one in two and a half million? No, you'll say. At which point, I'll take all the cards, shuffle the deck again, hand it to you and say, all right, smartass, you do it.

In other words, from a thoroughly shuffled deck, if you're not impressed with what I just did, you do it -- deal out exactly the same 5-card hand. Not so easy now, is it?

Hold on, you'll complain, that's not fair. Why, yes, you're right -- it isn't fair. And why not? It's because, when I dealt my hand, I never made any predictions or put any conditions on the outcome beforehand. I just dealt the hand and, after the fact, went back to rationalize (in a totally meaningless way) the odds of that having happened.

When I shuffle the deck and hand it to you, though, I'm asking you to duplicate, at random, what I just did. And that's a whole new problem.

You can see the same statistical misunderstanding if you walk up to a bridge game, look at each of the players' initial hand of 13 cards, and calculate the incredibly low probability of a random dealing having come up with exactly that set of hands.

Finally, others have referred to this mathematical misunderstanding as the "blade of grass" fallacy, in which a golfer hits a ball onto the green, walks up to his ball and stands there marveling that, out of all of the blades of grass the ball might have come to rest on, it stopped on just that one. How amazing. How incredibly improbable. How thoroughly bogus, as I'm sure you're starting to understand by now.

The mathematical fallacy should now be obvious -- there's no point in calculating the odds of something happening if it's just being done after the fact and there were no pre-conditions to start with. And this is precisely what the creationists/ID proponents do with things like the structure of DNA.

Look, they'll say, DNA is so marvelously complex. It has exactly these components in exactly this order. What are the odds of that? To which the correct answer is, that question is meaningless. It might have been just as likely some other structure that worked equally well.

At this point, I'm assuming most moderately sentient readers will understand the logical flaw in this creationist argument. And for those of you who don't, well, I have a deck of cards with your mathematically illiterate name on it.

FYI: PZ Myers (among many others) laid a beating on Chopra as well.

WEASEL BOY UPDATE: Apparently, Weasel Boy himself takes exception with my mathematical analysis in the comments section, proving only that he still doesn't get the point, referring to some sort of analogous "royal flush" of DNA. So here's what I'm going to do.

From a site on the net, I downloaded the human chromosome 6 sequence file. According to that site:

Chromosome 6 is a submetacentric chromosome that constitutes about 6% of the human genome. The finished sequence comprises 166,880,988 base pairs, representing the largest chromosome sequenced so far. The entire sequence has been subjected to high-quality manual annotation, resulting in the evidence-supported identification of 1,557 genes and 633 pseudogenes.

I downloaded the entire (174M) uncompressed sequence file and, from the four choices below, I want Weasel Boy to select the one that corresponds to the opening sequence of that chromosome. No cheating by looking it up. WB seems to think it should be obvious to distinguish a "royal flush" from meaningless random data so it should be a snap for him to pick out the actual opening sequence from the other three choices which are just random strings I pulled out of my ass.

So, Jinx, just from visual inspection, which of these strings actually corresponds to the beginning of human chromosome 6? Which of these, as you would put it, is the obvious "royal flush" as compared to the others?

1. CCATATAATTTATTAATTGTCTAGGAACTTCCACATACATTGCCTCAATT
2. TTATGCTTTCAAAATATTCTTTTGCTAATTCTTAGAACAAAGAAAGGCAT
3. AAATTTATTTGGTCCATTTTGTGAAAAACATAAAAAAAGAACTGTCACAT
4. GATCTTATATAACTGTGAGATTAATCTCAGATAATGACACAAAATATAGT

Go on, Jinx. Which one is it? Surely a clever boy like you can pick out the actual sequence from all that random data.

AFTERSNARK: I know that Jinx is going to hideously misunderstand this last challenge so let me clarify the point that is being made here for those of you whose brain stems are still functioning and have not been deadened by years of immersion in anti-intellectual fundamentalist Christianity.

The proponents of ID are constantly yammering on about how there is such obvious "design" or "complexity" in nature that it simply could not have arisen by chance. If this is indeed the case, then it should be simple to look at such examples and point out what it is about them that makes them "complex" or "designed" (whatever that means since these same proponents are singularly unable to provide even a vague working definition.)

With that in mind, I want Weasel Boy to pick out, from the four sequences above, the one that has that inherent "design" or "complexity" that distinguishes it from the random noise of the other three sequences. If he can't, then all of his arguments regarding probability and design are total hoo-hah.

Have I made my point?